Skip to content

Sanger Sequencing

Sanger Sequencing is performed on Applied Biosystems 3730 Genetic Analyzer, a 48 capillary electrophoresis instrument for DNA sequencing or DNA fragment analysis.  For full service sequencing, users provide templates and primers in separate tubes and we perform the sequencing reactions using Applied Biosystem’s BigDye version 3.1.  Some users choose to perform their own sequencing reactions and therefore provide dried "load only" reactions for sequencing at a discounted price.  There is a further discount for "load only" reactions delivered in 96-well trays. 

For DNA templates, 15ngs of DNA is required per 100 base pairs in 12 ul volumes or less.  DNA should be eluted in water for best results.  For example, a 5 kb plasmid requires 750 ng of template DNA.  For a 500 bp PCR product, 75 ng of template are required.Each primer constitutes one reaction, and primers should be provided at 10 uM concentration, 2 uL per reaction.  Good quality starting template DNA should provide about 800-1000 bases of good quality sequence.

Electronic sequencing results for Sanger sequencing are sent via email as .ab1 or .seq files.  The .seq file is an unedited text file used mostly for blasting into available databases.  The .ab1 file is the Applied Biosystems electropherogram (chromatogram) file that is generated using ABI's Sequencing Analysis Software.  There are many downstream applications that are available for use in the manipulation of the generated sequencing files.  The software Sequencher (GeneCodes) is available through the Genomics Core for installation on personal computers, allowing you to view, edit, and align multiple sequencing sample results files. 

Samples for Sanger sequencing that are quantified and in the lab by 11:00 am should be processed with results emailed to the client by approximately noon the following day.  All other services are performed on a first come, first served basis.The lab is open Monday thru Friday, 8:30AM – 4:30PM and is located in Walters Life Sciences Room A215.

We provide the commonly used plasmid primers listed below. 

M13Fwd (-20)   GTAAAACGACGGCCAGTG
M13Rev AGGAAACAGCTATGACCATG
T7 promoter TAATACGACTCACTATAGGG
T7 terminator GCTAGTTATTGCTCAGCGG
SP6 ATTTAGGTGACACTATAG


The flagship campus of the University of Tennessee System and partner in the Tennessee Transfer Pathway.