Skip to content

Services

Sanger Sequencing and Fragment Analysis

ABI 3730 Genetic AnalyzersSanger Sequencing and DNA SNP/fragment analysis (AFLP, RFLP, microsatellites) are performed on the ABI 3730 capillary electrophoresis instrument.  With good quality starting template DNA, users should expect about 800-1000 bases of good quality sequence.

Most users choose our full service sequencing, where they provide templates and primers in separate tubes and we perform the sequencing reactions.  The Genomics Core uses BigDye version 3.1 for all sequencing.  Please provide us with 15 ng of template DNA per 100 bp of total product length and 2 μl of 10 μM primer for each reaction requested.  DNA should be eluted in water.

Some users choose to perform their own sequencing reactions and bring us dried "load only" reactions at a discounted price.  There is a further discount for "load only" reactions delivered in 96-well trays. 

We provide the commonly used plasmid primers listed below.  We often have additional primers in stock, but please ask before assuming we have any primers not listed below.

M13Fwd (-20)   GTAAAACGACGGCCAGTG
M13Rev AGGAAACAGCTATGACCATG
T7 promoter TAATACGACTCACTATAGGG
T7 terminator GCTAGTTATTGCTCAGCGG
SP6 ATTTAGGTGACACTATAG

The ABI 3730 allows users to differentiate between 5 colors for DNA fragment analysis, allowing for 4 unknowns and a size standard per well. Our machine runs 48 samples at once.  Please contact us for advice on how to load your plate if running fewer than 48 samples.

The flagship campus of the University of Tennessee System and partner in the Tennessee Transfer Pathway.